BRAT1 links Integrator and defective RNA processing with neurodegeneration | Panda Anku

Cell lines and culture

Patient-derived hTERT-immortalized fibroblasts (denoted Patient 1) and lymphoblastoid cell lines (LCLs; denoted Patient 1 and Patient 2) generated from the affected siblings harboring a homozygous missense c.185T > A (p.V62E) variant in BRAT1, the control cells from the unaffected parents, both heterozygous for c.185T > A (denoted Father and Mother) and the unrelated control fibroblasts (denoted 1BR ctrl) or LCLs (denoted LCLs ctrl) have been described previously11. Written informed consent was obtained at the time the skin biopsies were performed to derive cell lines for future studies by the investigators. Human fibroblasts were cultured in Minimum Essential Medium Eagle (MEM; Gibco) supplemented with 15% fetal bovine serum (FBS; Gibco), 2 mM l-glutamine (Gibco), and the antibiotics penicillin (100 units/ml) and streptomycin (100 μg/ml) (Pen/Strep; Gibco) at 37 °C. LCLs were grown in Roswell Park Memorial Institute 1640 Medium (RPMI 1640; Sigma) supplemented with 10% FBS and the antibiotics Pen/Strep at 37 °C. Human wild-type osteosarcoma cells (U2OS) were cultured in Dulbecco’s Modified Eagle’s Medium-high glucose (DMEM-high glucose; Sigma) supplemented with 10% FBS and the antibiotics Pen/Strep at 37 °C.

Generation of BRAT1
−/− cell lines

BRAT1−/− gene edited U2OS cell lines were prepared using Cas9 and guide sequences designed in CRISPR direct (https://crispr.dbcls.jp):

gRNA1_1 TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTGCTGTTCTGGTAGATCCC, gRNA1_2 GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGGATCTACCAGAACAGCAC,

gRNA2_1 TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCTGCAGGAGCACCCCTGCC, gRNA2_2 GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGCAGGGGTGCTCCTGCAGC,

gRNA3_1 TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCCCAGGTTGCTCGGCCGA, gRNA3_2 GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTCGGCCGAGCAACCTGGGCC.

The selected CRISPR guide oligonucleotide pairs were annealed and extended into a 98-mer double-stranded fragment using Phusion polymerase (Sigma) and subcloned into the guide RNA cloning vector (Addgene; 41824) using Gibson Assembly (NEB). For gene editing, human U2OS cells were co-transfected by the appropriate guide oligonucleotide duplex and a Cas9 expression construct (Addgene; 41815) using Lipofectamine LTX (Life Technologies). Twenty-four hours later, the transfected cells were selected in a medium containing 0.5 mg/ml G418 (Roche) for 5 days. The obtained subclones were analyzed for expression of BRAT1 by indirect immunofluorescence and/or Western blotting. Finally, three clones were chosen for confirmation of gene editing by Sanger sequencing (clones #6, #8, and #16). Genomic DNA was isolated from wild-type U2OS cells and selected clones using QIAamp DNA mini kit (Qiagen; 51304) and PCR was performed to amplify regions of interest surrounding the specific BRAT1 guide RNA target loci using following pairs of primer:

BRAT1_gRNA1F-TGCAGTACAGACCTCTGG and

BRAT1_gRNA1R-AGTCTGCCACAGATAATCC,

BRAT1_gRNA3F-TGCCTCAGCCTTCTTAGTAGC and

BRAT1_gRNA3R-AGACATCGCACAGACCAGAC.

Amplicons were cloned into pCR2.1-TOPO plasmid by Topo TA cloning kit (Life Technologies; 45-0641) according to the manufacturer’s instructions prior to DNA sequencing with M13 forward primer (Eurofins).

Cloning and site-directed mutagenesis

Full-length wild-type human BRAT1 denoted BRAT1WT (UniProtKB: NP_ 689956.2, Q6PJG6) was cloned into the pDONR221 donor vector (Invitrogen; 12536017) via the BP recombination reaction as indicated by the manufacturer’s instructions (Invitrogen; 11789013). By Sanger sequencing verified pDONR221_BRAT1WT donor construct was used for insertion of BRAT1WT into the pMM330 entry vector via the LR recombinant reaction as indicated by the manufacturer (Invitrogen; 11791019). The resulting pMM330_BRAT1WT expression plasmid thus comprises a TEV-cleavable TwinStrep-FLAG-tag linked in-frame to the N-terminus of the BRAT1 sequence. To prepare BRAT1V62E construct, the site-directed mutagenesis was carried out by Q5 Site-Directed Mutagenesis Kit (BioTech; E0552S) according to the manufacturer’s protocol using mutagenic primers (BRAT1_V62E_F: CTGTCCCATGAGCTGAAAGTCCAGG and BRAT1_V62E_R: CAGCTCCACCAGGCAGGG) and the pMM330_BRAT1WT plasmid as a template. Desired pMM330_BRAT1WT and pMM330_BRAT1V62E constructs were verified by Sanger sequencing.

Plasmid DNA and siRNA transfection

BRAT1−/− (clone #8) U2OS cells were transfected by pMM330_BRAT1WT or pMM330_BRAT1V62E expression plasmids using a jetPRIME transfection reagent (Polyplus-transfection; 101000046) according to the manufacturer’s instructions. Transfected cells were fixed or collected for the experiments 24 h later. For siRNA-mediated depletion, U2OS cells were transfected with non-targeting siRNA (siNT; Dharmacon; D-001810-10 or Life Technologies; 4390843), SMART pool siRNA against INTS11 (siINTS11; Dharmacon; SO-2821252G) or siRNA against INTS9 (siINTS9; Life Technologies; 4392420) using Lipofectamine RNAiMAX (Life Technologies) as indicated by the manufacturer. Experiments were carried out 48 h post-transfection.

Antibodies

Primary antibodies used in this study were as follows: anti-BRAT1 (IF 1:500, WB 1:50,000; Abcam, ab181855), anti-INTS11 (WB 1:1000; Novus Biologicals, NB100-60638), anti-INTS11 (IF 1:500; Novus Biologicals, NBP3-03680), anti-INTS9 (WB 1:1000; Cell Signalling, 13945), anti-INTS4 (WB 1:1000; Abcam, ab75253), anti-INTS3 (WB 1:1000; Bethyl, A302-050A), anti-INTS1 (WB 1:1000; Bethyl, A300-361A), anti-β-actin (WB 1:5000; Protein Tech, 66009), anti-α-tubulin (WB 1:8000; Abcam, ab6160), anti-Lamin B (WB 1:500; Santa Cruz, sc-6216), anti-Coilin (IF 1:250, WB 1:1000; Santa Cruz, sc-32860), anti-B23 (IF 1:250; Santa Cruz, sc-271737) and anti-FLAG (IF 1:250, WB 1:500; Sigma, F1804). Secondary antibodies employed for western blotting were HRP-conjugated goat anti-rabbit (1:10,000; Bio-Rad, 170-6515), goat anti-mouse (1:10,000; Bio-Rad, 170-6516), rabbit anti-rat (1:10,000; Abcam, ab6734), for western blotting after immunoprecipitation HRP-conjugated light chain specific mouse anti-rabbit (1:10,000; Jackson Immunoresearch, 211-032-171) and for indirect immunofluorescence were goat anti-rabbit Alexa 488 (1:10,000; Invitrogen, A-11008) and donkey anti-mouse Alexa 647 (1:10,000; Invitrogen, A-31571).

SDS-PAGE and western blotting

Cells were collected and lysed in SDS sample buffer (2% SDS, 10% glycerol, 50 mM Tris-HCl, pH 6.8), denaturated for 10 min at 95 °C, and sonicated for 30 s using a Bioruptor® Pico (Diagenode). Protein concentrations were determined using the BCA assay (Pierce; 23227). DTT and bromophenol blue were added to samples, which were subjected to SDS-PAGE, proteins transferred onto nitrocellulose membrane and detected by the relevant primary antibody combined with horseradish peroxidase-conjugated secondary antibody. Induced peroxidase activity was detected using ECL reagent (GE Healthcare) and Amersham Hyperfilm ECL (GE Healthcare). The Amersham Hyperfilm ECL with detected protein signal was scanned and the digital image was analyzed using Image Studio Lite version 5.2 software (LI-COR Biosciences). The intensity of signal was normalized against the loading control (β-actin, α-tubulin, coilin or Lamin B).

Immunoprecipitation

Cells were washed twice with ice-cold PBS (Gibco) and lysed in 800 µl of ice-cold EBC buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.5% IGEPAL CA-630) supplemented with inhibitors of both proteases and phosphatases (Roche). Cell extracts were sonicated for 30 s using Q120 Sonicator (Qsonica) with 20% amplitude on ice followed by centrifugation at 20,000 × g for 10 min at 4 °C. Supernatants were incubated with 1 μg of relevant antibody overnight at 4 °C. Next day, immunoprecipitated complexes were immobilized on protein A/G UltraLink Resin (Life Technologies; 53132) for 2 h at 4 °C and washed by EBC buffer. Similarly, FLAG-tagged immunoprecipitates were incubated with anti-FLAG M2 affinity gel resin (Sigma; SLCH0130) for 2 h at 4 °C and washed by EBC buffer. Bound proteins were subjected to mass spectrometry or eluted with 2x SDS sample buffer and analyzed by SDS-PAGE and western blotting.

Mass spectrometry and data analysis

Immunoprecipitates from wild-type and BRAT1−/− (clone #8) U2OS cells were resuspended in 100 mM triethylammonium bicarbonate containing 2% sodium deoxycholate. Cysteins were reduced with 10 mM final concentration of tris(2‐carboxyethyl)phosphine and blocked with 20 mM final concentration of S-methylmethanethiosulfonate (60 °C for 30 min). Samples were cleaved on beads with 1 μg of trypsin overnight at 37 °C. After digestion samples were centrifuged and supernatants were collected and acidified with trifluoroacetic acid to 1% final concentration. Sodium deoxycholate was removed by extraction to ethylacetate59. Peptides were desalted using in-house made stage tips packed with C18 disks (Empore)60. Nano Reversed phase column (EASY-Spray column, 50 cm × 75 µm ID, PepMap C18, 2 μm particles, 100 Å pore size) was used for LC/MS analysis. Mobile phase buffer A was composed of water and 0.1% formic acid. Mobile phase B was composed of acetonitrile and 0.1% formic acid. Samples were loaded onto the trap column (Acclaim PepMap300, C18, 5 μm, 300 Å Wide Pore, 300 μm x 5 mm, 5 Cartridges) for 4 min at 15 μl/min. Loading buffer was composed of water, 2% acetonitrile and 0.1% trifluoroacetic acid. Peptides were eluted with Mobile phase B gradient from 4% to 35% B in 60 min. Eluting peptide cations were converted to gas-phase ions by electrospray ionization and analyzed on a Thermo Orbitrap Fusion (Q-OT- qIT, Thermo). Survey scans of peptide precursors from 350 to 1400 m/z were performed at 120 K resolution (at 200 m/z) with a 5 × 105 ion count target. Tandem MS was performed by isolation at 1.5 Th with the quadrupole, HCD fragmentation with normalized collision energy of 30, and rapid scan MS analysis in the ion trap. The MS/MS ion count target was set to 104 and the max injection time was 35 ms. Only those precursors with charge state 2–6 were sampled for MS/MS. The dynamic exclusion duration was set to 45 s with a 10 ppm tolerance around the selected precursor and its isotopes. Monoisotopic precursor selection was turned on. The instrument was run in top speed mode with 2 s cycles61. All data were analyzed and quantified with the MaxQuant software (version 1.6.2.1)62. The false-discovery rate (FDR) was set to 1% for both proteins and peptides and we specified a minimum peptide length of seven amino acids. The Andromeda search engine was used for the MS/MS spectra search against the Human database (downloaded from uniprot.org in July 2019, containing 20,444 entries). Enzyme specificity was set as C-terminal to Arg and Lys, also allowing cleavage at proline bonds and a maximum of two missed cleavages. Dithiomethylation of cysteine was selected as fixed modification and N-terminal protein acetylation and methionine oxidation as variable modifications. The “match between runs” feature of MaxQuant was used to transfer identifications to other LC-MS/MS runs based on their masses and retention time (maximum deviation 0.7 min) and this was also used in quantification experiments. Quantifications were performed with the label-free algorithms described recently. Data analysis was performed using Perseus 1.6.1.3 software63.

Cell fractionation

Human cells at 80% confluence were trypsinized and collected by centrifugation at 500 × g for 5 min at 4 °C. Pelleted cells were washed twice with ice-cold PBS, followed by resuspension in 5× packed cell volume of ice-cold hypotonic Buffer A (10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, and 0.5 mM PMSF) supplemented with protease and phosphatase inhibitors (Sigma) and incubation on ice for 5 min. Cells were centrifuged at 500 × g for 5 min at 4 °C, resuspended in 2× packed cell volume of supplemented Buffer A. Cells in hypotonic buffer were compressed by Dounce homogenizer 20 times using a tight-fitting pestle in 4 °C. Nuclei were collected by centrifugation at 500 × g for 5 min at 4 °C and supernatant was used as a cytoplasmatic fraction. Collected nuclei were lysed in SDS sample buffer (2% SDS, 10% glycerol, 50 mM Tris-HCl, pH 6.8) or ice-cold EBC buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.5% IGEPAL CA-630) and used for western blotting or immunoprecipitation experiments, respectively.

Immunofluorescence and microscopy

Cells cultured on glass coverslips were fixed in 4% formaldehyde for 10 min and subsequently permeabilized in ice-cold methanol/acetone solution (1:1) for another 10 min. After blocking with 10% FBS for 30 min, fixed cells were incubated with primary antibodies for 60 min, washed in PBS, and then incubated another 60 min with the appropriate fluorescently labeled secondary antibodies. Finally, after washing in PBS, nuclei were stained with DAPI and coverslips were mounted using anti-fading mounting reagent Vectashield (Vector Laboratories). High-resolution microscopy of fixed samples was carried out on Leica DM6000 fluorescence microscope, equipped with dry objectives (Plan-Apochromat 40×/0.75 and 20×/0.70). Automated wide-field microscopy was performed on an Olympus ScanR high-content screening station equipped with a motorized stage and 40x/0.95 (UPLSAPO 2 40×) dry objective. Nucleoli and nuclei were identified based on the B23 and DAPI signal, respectively, and nucleolar/nuclear coilin fluorescence intensity was quantified in the region colocalizing with B23/DAPI using ScanR Analysis Software. The relative coilin level in the nucleolus was calculated as the mean coilin fluorescence intensity in the nucleolus (defined by B23) normalized to the mean fluorescence intensity of coilin in the nucleus (defined by DAPI). At least 600 nuclei were analyzed per condition in three or four independent experiments.

Quantitative reverse-transcription PCR analysis

Total RNA was extracted from cells using the RNeasy mini kit with an additional DNase I digestion (Qiagen; 74104 and 79254) as indicated by the manufacturer. 1 μg of total RNA was reverse transcribed with RevertAid Reverse Transcriptase (Life Technologies) using random hexamer primers. Quantitative reverse-transcription PCR (RT-qPCR) was performed on a LightCycler 480 (Roche) using SYBR Green PCR Master Mix (Life Technologies) and following target primer pairs:

RNU1_total_F-CAGGGGAGATACCATGATCACGAAG and

RNU1_total_R-GGTCAGCACATCCGGAGTGCAATGG (U1 snRNA);

RNU1_F-GAAACTCGACTGCATAATTTGTGGTAG and

RNU1_R-CTTGGCGTACAGTCTGTTTTTGAAACTC (U1 snRNA unprocessed);

RNU2_F-AACATAGGTACACGTGTGCCACGG and

RNU2_R-ACAAATAGCCAACGCATGCGGGGC (U2 snRNA unprocessed);

RNU7-1_F-CAGTGTTACAGCTCTTTTAG and

RNU7-1_R-ATCATTGGCAACAAACATC (U7 snRNA unprocessed);

HIST1H4B_F-CATCTCAATGGCTTTACTCG and

HIST1H4B_R-ATAGCTCACTTATCTCGGAG (Histone H4 unprocessed);

c-FOS_pre_F-GGCTTTCCCCTTCTGTTTTG and

c-FOS_pre_R-TGGTCGAGATGGCAGTGAC (c-FOS pre-mRNA);

c-FOS_m_F-ACTACCACTCACCCGCAGAC and

c-FOS_m_R-TGGTCGAGATGGCAGTGAC (c-FOS mRNA);

c-FOS_total_F-TACCCAGCTCTGCTCCACAG and

c-FOS_total_R-AGGATGACGCCTCGTAGT (c-FOS exon1);

RPLP2_F-TCTTGGACAGCGTGGGTATCGA and

RPLP2_R-CAGCAGGTACACTGGCAAGCTT (Large Ribosomal Subunit Protein P2);

ACTB_F-CACCATTGGCAATGAGCGGTTC and ACTB_R-AGGTCTTTGCGGATGTCCACGT (Actin Beta).

The expression data were normalized to the data for reference genes ACTB and/or RPLP2. The relative expression was calculated by Pffafl method:

$${{{{{bf{RQ}}}}}}=frac{{{{{{{bf{2}}}}}}}^{Delta {{{{{rm{Ct}}}}}}({{{{{{mathrm{target}}}}}}})}}{{{{{{{bf{2}}}}}}}^{Delta {{{{{rm{Ct}}}}}}({{{{{{mathrm{reference}}}}}}})}}$$

Northern blotting

Total RNA was extracted from cells using TRIzol reagent (Life technologies) according to the manufacturer’s protocol and dissolved in urea sample buffer (20 mM Tris-HCl pH 8.0, 8 M urea, 0.2% xylene blue). The extracted total RNA was separated by denaturing 7.5 M urea polyacrylamide gel electrophoresis and transferred by capillarity to a positively charged nylon membrane (GE Healthcare; Amersham HybondTM-N + , RPN303B) overnight at room temperature. Millennium™ RNA Markers (Thermo Fisher Scientific; AM7150) were labeled with [γ-³²P]ATP (Hartmann Analytic; SCP-301) by T4 polynucleotide kinase (Thermo Fisher Scientific; EK0031) up to a final concentration 106 cpm/ml and used in parallel with RNA samples. The blotted RNA was crosslinked to the membrane in a UV Stratalinker 1800 using the short-wave UV light (254 nm, 120 mJ) for 1 min. The crosslinked membrane was pre-hybridized in the Church buffer (1% (w/v) BSA, 1 mM EDTA, 0.5 M Na2HPO4 * 12 H2O, 58.4 mM H3PO4, 7% SDS) for 2 h at 55 ˚C (U7 snRNA) or 65 ˚C (U1 snRNA, U2 snRNA, 5S rRNA), hybridized with the [γ-³²P]ATP-labeled U1 snRNA, U2 snRNA, U7 snRNA and 5S rRNA probes diluted in the Church buffer up to the final concentration 106 cpm/ml overnight at 55 ˚C (U7 snRNA) or 65˚C (U1 snRNA, U2 snRNA, 5S rRNA), and then washed.

U1 snRNA-CGCAGGGGTCAGCACATCCGGAGTGC,

U2 snRNA-AAATCCATTTAATATATTGTCCTCGG,

U7 snRNA-CTAAAAGAGCTGTAACACTG and

5S rRNA-TCTCCCATCCAAGTACTAACCAGGCCCGACC.

For detection of hybridized target probes, the membrane was exposed to a phosphor screen, which was then scanned by Amersham Typhoon™ biomolecular imager (GE Healthcare). The digital image was analyzed using Image Studio Lite version 5.2 software (LI-COR Biosciences).

Silver staining of RNA

Total RNA was extracted as above and separated on a 7.5 M urea gel. After fixation with 40% methanol containing 10% acetic acid for 1 h, incubation with 3.4 mM K2Cr2O7 and 3.2 mM HNO3 for 10 min and washing, the gel was stained with 12 mM AgNO3 for 30 min and developed with 280 mM Na2CO3 containing 0.02% formaldehyde. The reaction was stopped with 1–5% acetic acid and the stained gel was scanned and analyzed using Image Studio Lite version 5.2 software (LI-COR Biosciences).

RNA sequencing and data analysis

For the RNA-sequencing experiment, total RNA was isolated from 1 × 106 cells by miRNeasy Micro Kit (Qiagen; 217084) with an additional DNase I treatment, according to the manufacturer’s instructions. The quantity and quality of isolated RNA was measured using NanoDrop ND-2000 (NanoDrop Technologies) and analyzed by Agilent 2100 Bioanalyser (Agilent Technologies). RNA integrity number, which is regarded as criteria for high-quality total RNA, ranged between 9.9 and 10. For each sample, 3 ng of total RNA was used as input material for a library preparation by following the SMARTer Stranded Total RNA-Seq Kit v2—Pico Input Mammalian user manual (Takara Bio USA, Inc; 634412). Libraries were sequenced on the Illumina NextSeq® 500 instrument using 76 bp single-end configuration. Read quality was assessed by FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). For subsequent read processing, a bioinformatic pipeline nf-core/rnaseq version 1.4.2 was used (nf-core/rnaseq: nf-core/rnaseq version 1.4.2; Zenodo; https://doi.org/10.5281/zenodo.3503887). Individual steps included removing sequencing adaptors and low-quality reads with Trim Galore! (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/), mapping to reference genome GRCm38 (Ensembl annotation version 98) with HISAT2 and quantifying expression on gene level with featureCounts64,65,66. Per gene mapped counts served as input for differential expression analysis using DESeq2 R Bioconductor package67. Prior to the analysis, genes not expressed in at least two samples were discarded. We supplied experimental model assuming sample type (control vs BRAT1-defective) as main effect. Resulting per gene expression log2-fold-changes were used for differential expression analysis. Genes exhibiting absolute log2-fold change value of 1 or greater and statistical significance (adjusted p-value < 0.05) between compared groups of samples were considered as differentially expressed. Read coverage was visualized using the Integrative Genomics Viewer (IGV).

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Leave a Comment